HURI SURI

Arthropod Specific Primers Sequences
The primers below are arthropod primers that we will use as a positive control set for all arthropods:

Apdsp28s_F CCCTGTTGAGCTTGACTCTAGTCTGGC
Apdsp28s_R AAGAGCCGACATCGAAGGATC

These primers work very well, sometimes too well (you will sometimes get a band in your water control). The annealing temp is 55C. These primers will be useful, for example, if you have a DNA prep that is negative for Wolbachia. You could thus determine if the prep was good and can be used in PCR.